quantitect probe rt pcr master mix (Qiagen)
Qiagen is a verified supplier 
Qiagen manufactures this product 
99
Structured Review
Qiagen
quantitect probe rt pcr master mix
Quantitect Probe Rt Pcr Master Mix, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 18971 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quantitect+probe+pcr+kit+master+mix/Reverse+Transcription+QuantiTect+Probe+RT-PCR+Kit/pmc13098462-143-10-15
Average 99 stars, based on 18971 article reviews
Quantitect Probe Rt Pcr Master Mix, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 18971 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/quantitect+probe+pcr+kit+master+mix/Reverse+Transcription+QuantiTect+Probe+RT-PCR+Kit/pmc13098462-143-10-15
Average 99 stars, based on 18971 article reviews
quantitect probe rt pcr master mix - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Amplification:Article Title: Investigation of the Canine Leishmaniasis in Hatay/Turkey. Article Snippet: .. Amplification was performed using the Polymerase Chain Reaction:Article Title: Investigation of the Canine Leishmaniasis in Hatay/Turkey. Article Snippet: .. Amplification was performed using the Article Title: Overcoming the Challenge; In Vivo Efficacy of Miltefosine for Chronic Cutaneous Leishmaniasis. Article Snippet: Background Cutaneous Leishmaniasis (CL) is the most common form of leishmaniasis.. CL can be divided into two major groups: acute CL (ACL) and chronic CL (CCL).. The aim of this study is to compare the efficacy of miltefosin and pentavalent antimony compounds in vivo with the CCL patient samples. Article Title: A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp. Article Snippet: 0006-291X/$ see front matter Published by Elsevier Inc. http://dx.doi.org/10.1016/j.bbrc.2013.05.032 ⇑ Corresponding author.. Address: Centers for Disease Control and Prevention, National Center for Emerging and Zoonotic Infectious Diseases, Waterborne Disease Prevention Branch, 1600 Clifton Road NE, Mail Stop D-66, Atlanta, GA 30329, USA.. E-mail address: jin2@cdc.gov (N. Jothikumar). Article Title: Photoinduced electron transfer (PET) primer for nucleic acid amplification Article Snippet: Real-time PCR amplification was carried out using the iCycler iQ4® (Bio-Rad, California, USA) platform. .. The reaction mixture contained primers at concentrations of 250 nM of each forward and reverse primer, 2 μl of DNA, 10 μl of 2× Article Title: Effect of Hypericum thymbrifolium BOISS. ET NOE, Hypericum scabrum L. and Eryngium creticum LAM. plant extracts on Leishmania major, Leishmania tropica and Leishmania infantum/donovani strains and their cytotoxic potential. Article Snippet: .. For PCR analysis, 1.5 μL H20 (PCR grade water), 1 μL Forward Primer, 1 μL Reverse Primer, 0.5 μL Probe1, 0.5 μL Probe 2, 12.5 μL other:Article Title: Genotyping of Cutaneous Leishmaniasis Cases Detected Before and After Migration with Real-Time Polymerase Chain Reaction in Hatay Article Snippet: PZR analizi için 1,5 μL H20 (PCR grade water), 1 μL Article Title: Investigation of in vitro Efficacy of Miltefosine on Chronic Cutaneous Leishmaniasis Article Snippet: Probe 1: CCGTTTATACAAAAAATATACGGCGTTTCGGTTT—FL Probe 2: LC640-GCGGGGTGGGTGCGTGTGTG—PH Gerçek zamanlı PZR testi amacıyla hazırlanan toplam 25 μL’lik |